Cells were washed with PBS, fixed with 1% formaldehyde

in PBS and analysed using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA). A mouse IgG2b FITC-conjugated antibody was used as an isotype control for unspecific intracellular staining (BD Biosciences). Splenic CD11c+ DCs, CD11b+ macrophages/monocytes find more and CD4+ T cells from C57BL/6J FcγRIIb−/− and C57BL/6 mice at 1 year old were stained either with anti-mouse CD11c-APC, anti-CD11b-PE or anti-mouse CD4-APC antibodies. After surface staining, cells were fixed (PBS/formaldehyde 1%) and incubated with FITC-conjugated anti-HO-1 antibody in permeabilization buffer overnight. Cells were then washed and fixed in PBS/formaldehyde 1%. The expression of surface markers and HO-1 was determined by FACS. The PBMCs obtained after Ficoll separation were stained with PE-conjugated and APC-conjugated monoclonal antibodies against CD14 and CD4, respectively, for 30 min at 4°. Staining for both CD14 and CD4 allowed clear separation of populations and minimized cross-contamination.

After incubation with antibody conjugates for 20 min https://www.selleckchem.com/products/bay80-6946.html on ice, cells were washed twice in PBS/1% BSA and sorted using a FACSAria II (Becton Dickinson). Purity of CD4+ and CD14+ cells was always higher than 95% after sorting. RNA from CD4+ and CD14+ sorted population and PBMCs stimulated for 24 hr with 1 μg/ml LPS, 3 μg/ml methyl prednisolone and Cobalt-Protoporphyrin 1 μm, were extracted using Trizol (Invitrogen, Carlsbad, CA) according

to the manufacturer’s instructions. Reverse transcription PCR and cDNA synthesis were performed using random Edoxaban primers (ImProm-II; Promega, Madison, WI). Real-time PCR reactions were carried out using a Strategene Mx300P thermal cycler. Briefly, cDNAs amplified out of total RNA from CD4+ and CD14+ cells, were tested for amplification of HO-1 using the following primers (5′–3′): forward AGGCAGAGGGTGATAGAAGAGG, and reverse TGGGAGCGGGTGTTGAGT. The PCR amplification of glyceraldehyde 3-phosphate dehydrogenase (GADPH) or hypoxanthine phosphoribosyltransferase (HPRT) was used as an internal control. To corroborate amplification specificity, PCR products were subjected to a melting curve program. Abundance of HO-1 mRNA was determined from standard curves (correlation coefficient ≥ 0·98). Results were expressed as the ratio of the HO-1 amount relative to the amount of GADPH or HPRT for each sample, determined in duplicate experiments. The PBMCs were seeded at 106 cells per well and incubated with SEA for 36 hr. In some experiments, PBMCs were incubated with SEA (50 nm) and stained with APC-conjugated anti-CD4, PerCP-conjugated anti-CD69, PE-conjugated anti-IL-2 (permeabilized) and FITC-conjugated anti-CD25. The PBMCs were also incubated with different SEA concentrations (0·16 pm to 1 μm) for 36 hr and stained with APC-conjugated anti-CD4 and PerCP-conjugated anti-CD69. Data and statistical analyses were performed using prism 4 software (Graph Pad Software, Inc.