Three independent experiments were performed. The animal study was approved (#IMPPG013) by The Ethics Committee for Animal Care and Use from Federal University of Rio de Janeiro, RJ, Brazil. DNase activity Difco™ DNase Test Agar (BD; Becton, MI-503 nmr Dickinson and Company, Sparks, USA) was used to screen 17 USA400-related MRSA, as recommended by the manufacturer. Autolysis assay Autolysin activity was measured in 8 selected isolates as previously described [51], except that cells were grown in TSB 1% Glc. Hemolytic activity The δ-hemolysin (Hld), encoded by the hld gene, is codified within the rnaIII region and, consequently, the detection of δ-hemolysin is an indicative of

agr expression. Sixty USA400-related isolates were screened for hemolytic activity on sheep red blood (5%) agar plates (Plast Labor, RJ, Brazil) as previously described [52]. Gene expression For RNA preparations, bacterial cells grown in TSB (18h/37°C; 250 rpm) were obtained in the exponential

phase (OD600nm = 0.3) and in the stationary phase. Total RNA was prepared using the RNeasy Mini kit (Qiagen; Maryland, USA) and quantified by the Qubit 2.0 Fluorometer. The RNA quality was analyzed by running RNA-gel electrophoresis. The real-time quantitative PCR (RT-qPCR) was carried out using Power SYBR® Green RNA-to-CT TM 1-Step Kit (Applied Biosystems; Foster city, CA, USA) Cyclosporin A purchase as recommended, using ΔΔCt comparative method. Farnesyltransferase The primers and run conditions used for rnaIII, hla, psmα[53], sarA, mecA[54], spa, sasG, fnbA and fnbB genes and for the endogenous control rrna 16S are selleck inhibitor listed in Table 1. All primers designed for this study were validated as recommended (Guide to Performing Relative Quantitation of Gene Expression Using Real-Time Quantitative

PCR; Applied Biosystems). The run was performed in the Step One™ Real Time PCR System (Applied Biosystems). Data were analyzed using the Step One Software 2.2 (Applied Biosystems). Table 1 Primers used in Real Time qPCR Target gene Primer sequencea Amplicon length (bp) Reference rnaIII F: AATTTGTTCACTGTGTCGATAAT 135 This study R:TGGAAAATAGTTGATGAGTTGTT sarA F: TTCTTTCTCTTTGTTTTCGCTG 115 This study R: GTTATCAATGGTCACTTATGCT spa F: TGGTTTGCTGGTTGCTTCTTA 116 This study R: GCAAAAGCAAACGGCACTAC hla F: TTTGTCATTTCTTCTTTTTCCCA 169 This study R: AAGCATCCAAACAACAAACAAAT psmα F:TATCAAAAGCTTAATCGAACAATTC 176 53 R: CCCCTTCAAATAAGATGTTCATATC sasG F:GGTTTTCAGGTCCTTTTGGAT 192 This study R:CTGGTGAAGAGCGAGTGAAA fnbpA F: ACTTGATTTTGTGTAGCCTTTTT 185 This study R:GAAGAAGCACCAAAAGCAGTA fnbpB F:CGTTATTTGTAGTTGTTTGTGTT 118 This study R:TGGAATGGGACAAGAAAAAGAA rrna 16S F: AGAGATAGAGCCTTCCCCTT 84 This study R:TTAACCCAACATCTCACGACA mecA F:TCCAGATTACAACTTCACCAGG 162 54   R:CCACTTCATATCTTGTAACG     aF and R: forward and reverse primers, respectively, in 5´→ 3´orientation.