RNA was then treated with DNase (Promega, Madison,

WI) to digest any contaminating genomic DNA and reverse transcribed with script cDNA synthesis reagents (Bio-Rad, Hercules, CA). Negative controls were included that were not exposed to reverse transcriptase. SYBR® Green PCR Master Mix (Applied Bios stems, Carlsbad, CA) amplified the cDNA with the following real-time primers: GAPDH forward 5’ – AACAGCGACACCCACTCCTC – 3’, GAPDH reverse 5’ –CATACCAGGAAATGAGCTTGACAA– 3’, chlamydia 16 F 5’ – TCGAGAATCTTTCGCAATGG AC – 3’, and chlamydia 16R 5’ – CGCCCTTTACGCCCAATAAA – 3’ as previously described [59, 60]. Arbitrary units were assigned using standard curves with five 1:3 serial dilutions for each target gene. Samples were reported as ratios of 16S: GAPDH. Immunocytochemistry and microscopy C. Selleck BMS202 trachomatis-infected HeLa cells with or without 405 nm were buy Rabusertib fixed with ice-cold see more methanol for 10 min. After aspiration, culture wells were washed with PBS and then stained with rabbit anti-C. trachomatis EBs (Virostat, Portland, ME) for 1 h. Wells were washed five times with PBS and counterstained with 4’, 6-diamidino-2’-phenylindole, dihydrochloride (Dapi; Thermo Scientific, Rockford, IL) for 10 min. Photos were obtained

using the Olympus IX51 Fluorescent Microscope with differential interference contrast (DIC) filters. Statistical analysis Due to different light intensities used for the 405 nm and 670 nm experiments, data were analyzed separately. In addition, both the replicated 405 nm and 670 nm experiments were repeated and therefore variation was partitioned between the separate experiments using a blocking factor [61]. Separate one-factor analyses of variance (ANOVA) were used to determine if 16S: GAPDH ratio, IL-6, and CCL2 production varied with treatment. For 405 nm treatments, post-hoc contrasts consisted of comparing C. trachomatis infected cells with uninfected cells and also examining C. trachomatis-infected cells exposed to different 405 nm densities (5-20 J/cm2). Additionally, penicillin-induced C. trachomatis infection was compared to C. trachomatis infected HeLa

cells alone and penicillin-induced C. trachomatis infection with 405 nm treatment. The Bonferonni method (40) was used to establish a critical P- PTK6 value. Acknowledgements This work was supported by the Lake Erie College of Osteopathic Medicine (LECOM) and the Lake Erie Consortium for Osteopathic Medical Training Grant (TS, NA, JS). It was also funded by James J. Duratz Undergraduate Student Research Awards (JZ, CW) and a Faculty Research Grant (TS) through Gannon University, and a research grant from the Beta Beta Beta Research Foundation (CW). We would like to thank Sean Beckmann and Naraporn Somboonna for their review of the manuscript, as well as Ashley Wimer for her assistance in the laboratory. References 1. Resnikoff S, Pascolini D, Etya’ale D, Kocur I, Pararajasegaram R, Pokharel GP, Mariotti SP: Global data on visual impairment in the year 2002.